About Our Database FAQs

Release date	March 7, 2008	Total number of genes	32,225
Total number of libraries	poly(A): 17 + small RNA: 35	Protein coding	29,611
Annotation built on	TAIR 7	Transposon related	2,614

The new small RNA data is described in Science 309: 1567-1569 and Genome Research (published online Sep 5, 2006).

Access to this web site and the gene expression data contained herein are provided for research purposes only. No commercial rights of any nature are granted. Parties interested in commercial applications should communicate with the Office of the Vice Provost for Research, University of Delaware, (302) 831-4230.

We have added SBS and 454 small RNA data to the site, in addition to our MPSS small RNA libraries; the small RNAs are visible through all of our normal visualization and data access tools. The following links provide examples of regions in which small RNAs match to specific genomic features:

	known microRNAs:	miRNA & miRNA* Sequences miRNA Targets miR167a miR172b
	inverted repeats:	Chr. 1 Chr. 5
	tandem repeats:	TR2558 180 bp repeat FWA
	pericentromeric region:	Chr. 1 Chr. 5
	weakly predicted transposons:	At4g04710 IGR-Chr.4
	trans-acting siRNAs	TAS1a TAS1b TAS1c TAS2 TAS3

Basic Queries

First choose a database for the mRNA data (17 bp data is available for MPSS small RNAs and full length for SBS and 454 sequences):

Next in the box below, enter specific information to retrieve MPSS map or data:

	Protein entry code (e.g. At3g62980)
	BAC clone name (e.g. F27M3)
	Sequence of mRNA MPSS signature (e.g. GATCCAGAGGATGTACA)
	Sequence of small RNA MPSS signature (e.g. AGAATCTTGATGATGCTGCAT)
	Keyword for predicted protein function (e.g. actin)

Query by Chromosome Position

First choose a database:

Next click on a region of any chromosome for which you would like to retrieve the MPSS map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position.

Image of chromosomes