About Our Database FAQs

Release date	April 10, 2009	Total number of genes	33,469
Total number of libraries	poly(A): 17 + PARE: 7	Protein coding	29,569
Annotation built on	TAIR 8	Transposon related	3,900

PARE, pronounced 'pair', stands for "Parallel Analysis of RNA Ends". The new PARE data is described in Nature Biotechnology 26:941-946. An overview of the PARE method is shown in this pdf. The small RNA data from that paper and and our other short-read-based Arabidopsis databases are accessible and described on our index page.

	known microRNAs:	miRNA & miRNA* Sequences miR167a miR172b
	known microRNA targets:	miRNA Targets At1g30490 At3g11440 At2g28350
	trans-acting siRNAs	TAS1a TAS1b TAS1c TAS2 TAS3

Access to this web site and the gene expression data contained herein are provided for research purposes only. No commercial rights of any nature are granted. Parties interested in commercial applications should communicate with the Office of the Vice Provost for Research, University of Delaware, (302) 831-4230.

Basic Queries

First choose signatures to display: mRNA and/or PARE signatures
Next choose libraries to display: mRNA libraries PARE libraries

In the box below, enter specific information to retrieve map or data:

	Protein entry code (e.g. AT3G62980)
	Sequence of mRNA MPSS signature (e.g. GATCCAGAGGATGTACAAAA)
	Sequence of PARE signature (e.g. TTGGACTCTTTTATCCTTTT)
	Keyword for predicted protein function (e.g. MIRNA)

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position.

Image of Arabidopsis chromosomes