About Our Database    FAQs

Release date January 15, 2009 Total number of genes 33,469
Total number of libraries small RNA: 13 Protein coding 29,569
Annotation built on TAIR 8 Transposon related 3,900

Some of this SBS small RNA data is from our paper on PARE in Nature Biotechnology 26:941-946, with additional data on this site gathered from other labs' publications. The PARE data and and our other short-read-based Arabidopsis databases are accessible and described on our index page.
    known microRNAs: miRNA & miRNA* Sequences      MIR167a      MIR172b
    inverted repeats: Chr. 1       Chr. 5       IR-71
    tandem repeats: TR2558      180 bp repeat      FWA
    pericentromeric region: Chr. 1      Chr. 5
    weakly predicted transposons:   AT4G04710      IGR-Chr.4
  trans-acting siRNAs TAS1a      TAS1b      TAS1c      TAS2      TAS3

Access to this web site and the gene expression data contained herein are provided for research purposes only. No commercial rights of any nature are granted. Parties interested in commercial applications should communicate with the Office of the Vice Provost for Research, University of Delaware, (302) 831-4230.

Basic Queries

First choose libraries to display: small RNA libraries

In the box below, enter specific information to retrieve map or data:

  Protein entry code (e.g. AT3G62980)
  Sequence of small RNA signature (e.g. AGAATCTTGATGATGCTGCAT)
  Keyword for predicted protein function (e.g. MIRNA)

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position.

Image of Arabidopsis chromosomes


If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.
Chr #:    Start Coordinate:    End Coordinate:    


Top