Maize SBS: Gene Analysis

The basic information for the genes you have selected is listed below. The "Small RNA Information" section lists all of the small RNA signatures that have been sequenced in any of our libraries. The "Exon information" section describes the exons that comprise this gene. Use the navigation bar to move to the next or previous gene or intergenic region (IGR).

Gene	Chr	Strand	Gene Type	5' End	3' End
Zm_chr01_cg_00500	1	w	protein-coding gene	2,022,251	2,023,000

Predicted function: putative protein

No splice variant annotated for this gene.
Link to the following for this gene:
Link to chromosome viewer for region around this gene
Extract sequence for this gene

Small RNA Information

Number of signatures retrieved: 16
Number of unique signatures retrieved: 16

#	Signature	Hits	Coordinate	Strand	Len	T	Zma1	Zma2	Zma3	Smop1	Swt
Signature abundances normalized to (varies by library depth):							1M	1M	1M	1M	1M
1	AGATATGTTACAGATCAGTCAGTG	1	2,022,431	w	24	S	0	0	1	0	0
2	TTGCAGTAGCACTGACTGATCT	1	2,022,463	c	22	S	0	0	0	1	0
3	TTGTTGGTTATCCATGAGCATA	1	2,022,580	c	22	S	0	0	0	1	0
4	GTTCGTCTGAAGAATGGTACGCAA	1	2,022,614	c	24	S	0	0	1	0	0
5	ATCGTGTTCGTCTGAAGAATGGTA	1	2,022,619	c	24	S	1	0	0	0	0
6	TTCGGATGAGCAGCGAACGCAGAG	1	2,022,637	w	24	S	0	0	1	0	0
7	TCGGATGAGCAGCGAACGCAGA	1	2,022,638	w	22	S	0	0	0	1	0
8	CGAAGAGAGCTGCAGGAATGGGAT	1	2,022,670	w	24	S	0	0	0	0	1
9	ATCAGAATATTCAGTTATCCCATT	1	2,022,709	c	24	S	0	0	1	0	0
10	GAGATTGTTTCTGACCAGGGAGCA	1	2,022,731	w	24	S	0	0	1	0	0
11	GAAAAGGTGTGGAACGCACGGCTG	1	2,022,879	w	24	S	0	0	0	0	1
12	AGGTGTGGAACGCACGGCTGTCGA	1	2,022,883	w	24	S	0	0	1	0	0
13	GGTGTGGAACGCACGGCTGTCGAC	1	2,022,884	w	24	S	0	0	0	0	1
14	TAGACACTGAATCCTCATAGCCAT	1	2,022,944	c	24	S	0	1	0	0	0
15	CCTCGACGCTAGAGCCCAAGACGT	1	2,022,989	w	24	S	0	0	0	0	1
16	CTCGACGCTAGAGCCCAAGACGT	1	2,022,990	w	23	S	0	0	0	0	1
Sum of abundance for signatures							1	1	6	3	5
Number of expressed distinct signatures							1	1	6	3	5

Exon Information

Number of exons retrieved: 1

Beginning of start codon: 2,022,250 bp
End of stop codon: 2,023,001 bp

#	Exon Contents	5' End	3' End	Size (bp)
1	ORF + UTRs	2,022,251	2,023,000	749
Within 3' UTR