Maize SBS: Small RNA Signature Analysis

The basic information for the tag you selected is listed below. In the second table, all occurrences of this tag are listed regardless of the genomic location you selected.

Sequence: AGCACATAGACATCCGGCATCACT   Length: 24 nucleotides
Technology: SBS   

Number of hits found: 226

Chr	Strand	Coordinate	Gene	Gene strand	Gene start	Gene stop	Gene function
1	w	3,038,018	Link to CV in this region

Other perfect matches found in genome in addition to that listed above.

Chr	Strand	Coordinate	Gene	Gene strand	Gene start	Gene stop	Gene function
9	w	4,530,203	Link to CV in this region
9	w	5,116,723	Link to CV in this region
4	w	3,172,726	Link to CV in this region
1	w	3,546,930	Link to CV in this region
4	w	16,849,383	Link to CV in this region
1	w	4,053,830	Link to CV in this region
4	w	15,119,296	Link to CV in this region
9	w	893,022	Link to CV in this region
9	w	525,442	Link to CV in this region
4	w	11,075,830	Link to CV in this region
9	w	5,333,163	Link to CV in this region
1	w	3,032,549	Link to CV in this region
9	w	2,764,738	Link to CV in this region
1	w	1,746,676	Link to CV in this region
4	w	2,534,876	Link to CV in this region
4	w	20,525,375	Link to CV in this region
4	w	10,750,922	Link to CV in this region
4	w	21,333,087	Link to CV in this region
1	w	812,778	Link to CV in this region
1	w	3,227,690	Link to CV in this region
4	w	3,307,140	Link to CV in this region
1	w	3,075,047	Link to CV in this region
4	w	131,379	Link to CV in this region
1	w	6,073,711	Link to CV in this region
4	w	15,857,906	Link to CV in this region
9	w	2,942,136	Link to CV in this region
4	w	3,349,226	Link to CV in this region
4	w	17,201,934	Link to CV in this region
4	w	5,172,612	Link to CV in this region
4	w	19,777,306	Link to CV in this region
4	w	17,628,684	Link to CV in this region
1	w	6,085,669	Link to CV in this region
4	w	17,350,551	Link to CV in this region
4	w	1,160,358	Link to CV in this region
4	w	986,940	Link to CV in this region
4	w	18,177,965	Link to CV in this region
4	w	18,320,594	Link to CV in this region
4	w	12,927,795	Link to CV in this region
4	w	12,918,773	Link to CV in this region
4	w	13,445,538	Link to CV in this region
4	w	2,856,123	Link to CV in this region
4	w	12,926,443	Link to CV in this region
4	w	15,353,408	Link to CV in this region
4	w	11,295,387	Link to CV in this region
4	w	20,604,413	Link to CV in this region
1	w	5,056,979	Link to CV in this region
1	w	1,616,578	Link to CV in this region
1	w	2,903,699	Link to CV in this region
4	w	8,134,846	Link to CV in this region
9	w	3,697,285	Link to CV in this region
9	w	6,141,079	Link to CV in this region
1	w	4,595,384	Link to CV in this region
4	w	13,953,065	Link to CV in this region
4	w	15,411,693	Link to CV in this region
1	w	2,387,475	Link to CV in this region
9	w	1,656,732	Zm_chr09_cg_00560	w	1,620,001	1,684,739	putative protein
4	w	5,880,982	Link to CV in this region
4	w	15,162,832	Link to CV in this region
9	w	2,277,553	Link to CV in this region
4	w	12,191,609	Link to CV in this region
1	w	1,706,601	Link to CV in this region
1	w	1,611,095	Link to CV in this region
1	w	311,143	Link to CV in this region
4	w	10,588,974	Link to CV in this region
4	w	463,118	Link to CV in this region
4	w	11,453,545	Link to CV in this region
1	w	3,419,282	Link to CV in this region
1	w	3,467,131	Zm_chr01_cg_00930	c	3,429,466	3,508,711	putative protein
1	w	115,846	Link to CV in this region
4	w	15,559,932	Link to CV in this region
1	w	1,404,258	Link to CV in this region
1	w	1,237,397	Link to CV in this region
1	w	1,228,478	Link to CV in this region
1	w	2,425,614	Link to CV in this region
4	w	9,506,620	Link to CV in this region
4	w	12,203,958	Link to CV in this region
4	w	9,499,638	Link to CV in this region
4	w	16,463,156	Link to CV in this region
4	w	10,481,974	Link to CV in this region
1	w	7,249,286	Link to CV in this region
4	w	20,813,730	Link to CV in this region
4	w	260,421	Link to CV in this region
4	w	6,603,754	Link to CV in this region
4	w	3,597,048	Link to CV in this region
9	w	5,866,578	Link to CV in this region
4	w	13,330,405	Link to CV in this region
4	w	5,240,005	Link to CV in this region
4	w	19,827,871	Link to CV in this region
4	w	17,056,553	Link to CV in this region
1	w	7,500,876	Link to CV in this region
9	w	52,470	Link to CV in this region
4	w	5,023,494	Link to CV in this region
9	w	1,199,529	Link to CV in this region
9	w	5,859,517	Link to CV in this region
1	w	894,395	Link to CV in this region
4	w	18,187,827	Link to CV in this region
4	w	11,386,279	Link to CV in this region
4	w	15,788,510	Link to CV in this region
1	w	5,323,730	Link to CV in this region
4	w	3,959,688	Link to CV in this region
9	w	848,920	Link to CV in this region
9	w	874,133	Link to CV in this region
4	w	10,124,022	Link to CV in this region
4	w	4,030,192	Link to CV in this region
4	w	5,360,197	Link to CV in this region
9	w	2,152,439	Link to CV in this region
4	w	12,993,097	Link to CV in this region
4	w	4,154,961	Link to CV in this region
1	w	2,409,929	Link to CV in this region
4	w	21,520,430	Link to CV in this region
1	w	3,316,678	Link to CV in this region
1	w	7,087,359	Link to CV in this region
4	w	12,893,524	Link to CV in this region
1	w	1,731,665	Link to CV in this region
4	w	16,687,200	Link to CV in this region
9	w	2,634,759	Link to CV in this region
4	w	8,735,455	Link to CV in this region
4	w	3,624,166	Link to CV in this region
4	c	3,166,101	Link to CV in this region
1	c	761,736	Link to CV in this region
4	c	3,512,043	Link to CV in this region
4	c	2,609,799	Link to CV in this region
9	c	1,129,629	Link to CV in this region
4	c	1,410,710	Link to CV in this region
1	c	5,510,169	Link to CV in this region
4	c	7,738,975	Link to CV in this region
4	c	9,312,951	Link to CV in this region
4	c	728,722	Link to CV in this region
1	c	2,708,076	Link to CV in this region
4	c	18,122,904	Link to CV in this region
4	c	4,466,574	Link to CV in this region
4	c	12,798,699	Link to CV in this region
4	c	9,310,576	Link to CV in this region
4	c	19,891,859	Link to CV in this region
4	c	4,891,476	Link to CV in this region
1	c	4,965,280	Link to CV in this region
4	c	5,765,918	Link to CV in this region
9	c	3,390,952	Link to CV in this region
4	c	20,372,520	Link to CV in this region
4	c	15,845,241	Link to CV in this region
4	c	1,153,332	Link to CV in this region
1	c	1,643,111	Link to CV in this region
1	c	1,738,649	Link to CV in this region
4	c	11,105,766	Link to CV in this region
4	c	17,193,590	Link to CV in this region
9	c	3,027,476	Link to CV in this region
4	c	18,050,689	Link to CV in this region
4	c	3,966,774	Link to CV in this region
9	c	3,671,086	Link to CV in this region
4	c	17,891,266	Link to CV in this region
1	c	1,751,705	Link to CV in this region
1	c	1,849,183	Link to CV in this region
4	c	10,193,922	Link to CV in this region
4	c	11,548,621	Link to CV in this region
1	c	1,256,142	Link to CV in this region
1	c	1,429,709	Link to CV in this region
1	c	1,275,008	Link to CV in this region
4	c	8,169,170	Link to CV in this region
9	c	3,884,287	Link to CV in this region
4	c	9,740,096	Link to CV in this region
9	c	5,585,423	Link to CV in this region
4	c	17,715,588	Link to CV in this region
1	c	7,329,046	Link to CV in this region
1	c	7,337,271	Link to CV in this region
1	c	4,417,164	Link to CV in this region
4	c	12,453,141	Link to CV in this region
4	c	12,310,071	Link to CV in this region
1	c	6,080,790	Link to CV in this region
9	c	2,933,513	Link to CV in this region
4	c	13,992,416	Link to CV in this region
9	c	823,474	Link to CV in this region
4	c	1,786,836	Link to CV in this region
9	c	3,394,050	Link to CV in this region
1	c	3,402,299	Link to CV in this region
9	c	2,678,161	Link to CV in this region
9	c	3,422,000	Link to CV in this region
1	c	132,866	Link to CV in this region
4	c	21,688,126	Link to CV in this region
4	c	9,804,573	Link to CV in this region
4	c	15,444,871	Link to CV in this region
1	c	1,724,283	Link to CV in this region
4	c	322,761	Link to CV in this region
1	c	5,676,254	Link to CV in this region
1	c	5,973,564	Link to CV in this region
1	c	6,039,133	Link to CV in this region
1	c	5,148,730	Link to CV in this region
1	c	3,159,859	Link to CV in this region
1	c	6,476,972	Link to CV in this region
4	c	4,037,748	Link to CV in this region
4	c	11,842,863	Link to CV in this region
4	c	9,775,626	Link to CV in this region
1	c	3,389,704	Link to CV in this region
4	c	10,595,265	Link to CV in this region
1	c	868,185	Link to CV in this region
9	c	145,612	Link to CV in this region
4	c	13,698,657	Link to CV in this region
4	c	9,579,312	Link to CV in this region
1	c	956,760	Link to CV in this region
4	c	18,131,563	Link to CV in this region
4	c	11,363,180	Link to CV in this region
4	c	14,698,372	Link to CV in this region
4	c	1,210,070	Link to CV in this region
4	c	2,766,425	Link to CV in this region
4	c	17,038,041	Link to CV in this region
4	c	17,067,051	Link to CV in this region
4	c	5,633,631	Link to CV in this region
1	c	5,421,962	Link to CV in this region
1	c	2,700,435	Link to CV in this region
4	c	1,192,689	Link to CV in this region
4	c	13,902,827	Link to CV in this region
1	c	7,358,340	Link to CV in this region
4	c	7,966,750	Link to CV in this region
1	c	6,334,745	Link to CV in this region
1	c	4,110,635	Link to CV in this region
4	c	3,009,847	Link to CV in this region
1	c	7,311,466	Link to CV in this region
4	c	12,300,628	Link to CV in this region
4	c	3,807,710	Link to CV in this region
4	c	2,320,406	Link to CV in this region
4	c	14,394,062	Link to CV in this region
4	c	4,838,080	Link to CV in this region
4	c	20,974,503	Link to CV in this region
9	c	4,377,508	Link to CV in this region
9	c	1,516,167	Link to CV in this region
1	c	6,090,868	Link to CV in this region

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data				Normalization Denominator
Data type	Raw	Total		1M
Zma1	0	902,720		0
Zma2	0	1,146,040		0
Zma3	1	945,061		1
Smop1	4	2,176,891		2
Swt	1	1,081,263		1

View library expression ratios for this tag.

---

Top  Back  Home