About Our Database   FAQs

Release date November 16, 2007 Total number of genes 21,452
Total number of libraries small RNA: 10 Protein coding 21,452
Annotation built on WASHUC 2 Transposon related 0
Access to this web site and the gene expression data contained herein are provided for research purposes only. No commercial rights of any nature are granted. Parties interested in commercial applications should communicate with the Office of the Vice Provost for Research, University of Delaware, (302) 831-4230.

Basic Queries

  Keyword: (e.g. Myosin, miR-17)
  Sequence of small RNA SBS signature (e.g. ACAAATGATGATTATAAGGGACTTAATACTGAA)
  Protein entry code (e.g. ENSGALT00000033265)
  BAC clone name (e.g. TAM32-11L17)

Query by Chromosome Position


Click on a region of any chromosome for which you would like to retrieve the SBS map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position.

Image of chromosomes


If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.
Chr #:    Start Coordinate:    End Coordinate:    


Top