About Our Database    FAQs

Release date September 20, 2009 Total number of genes 1,076
Total number of libraries small RNA: 5 Protein coding 1,076
Annotation built on Wing Lab & CSHL 8.0 Transposon related 0

Several of the small RNA libraries and the Chr. 4 contig are described in a paper submitted to the journal PLoS Genetics. The SBS small RNA data from two of the libraries were described in our paper on the maize mop1-1 mutant in the journal Proceedings of the National Academy of Sciences (PNAS).
    known microRNAs: miRNA & miRNA* Sequences     

Access to this web site and the gene expression data contained herein are provided for research purposes only. No commercial rights of any nature are granted. Parties interested in commercial applications should communicate with the Office of the Vice Provost for Research, University of Delaware, (302) 831-4230.

Basic Queries

First choose libraries to display: small RNA libraries

In the box below, enter specific information to retrieve map or data:

  Protein entry code (e.g. Zm_chr01_cg_00500)
  Sequence of small RNA signature (e.g. AGCACATAGACATCCGGCATCACT)
  Keyword for predicted protein function (e.g. protein)

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position.

Image of chromosomes


If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.
Chr #:    Start Coordinate:    End Coordinate:    


Top